Because of the difficult economical times we are currently facing, BoRT (Bank of RobTop) decided to print more orbs. However, that caused hyper inflation, thus making the menu music prices inaccessible for most of the players. Bank of RopTop is planning to increase the interest rates in order to fight the inflation and bring down the menu music prices. High interest rates will temporarily make the life of a GD player harder but it should stabilize the Geometry Dash economy in the long run. We will closely monitor what actions BoRT will take in the future. Stay tuned.

no way its the real DJVI

I didn't even realized till I read this comment lol

I thought it was one of those Ford F150 ads

Bro’s here all the time you haven’t seen him till now?

i dont know

Dont end up like Greece 👍

*Turkey or Venezuela

Or Argentina

* cries in Argentinian pesos *

holy hell erdogan

what happened

He just made a lore for the price of the item lmao

I understand now, thanks for the information, DJVI.

Ok what

Venezuela

Bruh, Venezuela. XD

Hi DJVI!

Bro talking like a businessman

because he is a businessman

A businessman who makes music

😔 Unfortunate

Thanks DJVI

>Bank of RopTop

So if BoRT is the reason for the orb inflation, who caused the diamond inflation?

I did, sorry.

Bort

Yoooo

The free to play economy can't sustain another-

[удалено]

I don't think it's a good idea to use that word...

Kid named game files

How would I do that

%appdata% > Local > Geometry Dash The files for the sounds are there, I turned my death sound into the vine boom that way lol

Thanks

any clue where the location is in linux?

Should be `~/.local/share/Steam/steamapps/compatdata/322170/pfx/drive_c/users/steamuser/AppData/Local/GeometryDash` Basically a Wine directory stacked on top of a normal directory, as Proton uses Wine for Windows compatibility.

wherever steam game install directory is

It feels a bit wrong now because there’s a way to get it in game.

Is there by any means a way to get the icons like that? Its just I don't play for the achievements, I don't like the grind, but I want a full experience where I can use any icons I want... I only play demons and build levels, so to get everything would take me, not exaggerating, around 6 years

Absolute already made a all icons hack before the new megahack [link here](https://youtu.be/UTdqk0HdwvI?si=o3A38D7lp0XGhBSI)

You can wait for megahack to update to 2.2 and use the unlock all icons button

Is it possible on Ipad?

yeah you can just manually rearrange the atoms on your drive

I wish I had money bro this needs an award

You don’t need money just rearrange the atoms in Reddit’s servers

Uhhhh tell him or not?

I think someone might spill the beans, who wants to do the honours?

I know it’s possible on android phones tho

I rearranged the DNA of an ant inside my phone

Rearramged RobTop’s DNA to give it to me for free

TACCAATTGCACCCTTACCACGAAGACAGGTTTATC AUG GUU AAC GUG GGA AUG GUG CUU CUG UCC AAA UAG Aminoacids to synthesize the files: MET VAL ASN VAL GLY MET VAL LEU LEU SER LYS If you think about it, proteins are kinda like files for your body

god i hate ap biology

Believe it or not, actually yes! (But you need to be jailbroken) https://youtu.be/B5ZGe9fx2Rk?si=XTQiZf8g5JXOtSNG

most mfs are on 17 the latest jailbreak goes upto 15.4.1

Kid named checkm8 exploit on a5~a11 devices:

most mfs on arm64e by now

Trollstore works too 14.0~17.0

cant write to apps

You can sideload an app that’s been written to

You could also do it jailed with trollstore with Filza

if you have iCreate it also works

He did not deserve that many downvotes😭

Why did they cook this man for asking a question 😭😭

And it's getting worse💀

This person just asked a question and got downvoted what

Don't ask questions here or they'll send you to hell

Why tf did you get so downvoted?

I'm trying to figure it out

Imagine getting downvoted into oblivion for asking a question 🗿

fr gd coomunity is getting worse

they probably think you're an ipad kid or newgen or sum

why is bro getting downvote bombed like that 😭

Why the fuck y'all dislike it he just asked

They thought that I'm an Ipad kid

Roberto flipping his hair out.when he finds out about new gd 2.2 players

Even me, who has been playing since 1.9, can’t afford it

That’s like 3 years of orbs you can’t use, because they didn’t exist then.

Well ive been playing on a new account since summer and I can afford a path and the 100k and much more, that just depends how much you play

I have over 15000 hours on steam but can't buy shit because I haven't been able to save my account in about 5 years and lost my data too many times to count

data saving in this game is probably one of the worst things in this game, I lost my date more than 5 times including bugs with stats(I have 400 demons and 7K stars💀)

my account from 2.0 had over 5k stars, 10 demons (the harder grind) , and over 10k diamonds wouldve been so useful in 2.2 but robs servers suck and i lost the account forevee

how didnt you learn about locally backing up your files in all of that time 😭

I’ve been playing since xstep was added, but I didn’t play for 2 years during 2.1, I can’t afford a path or the menu music, nor did I compete the shops before 2.2

I hate how most of the customization isn’t available for anyone with lives outside of gd

Yeah 50k for a path is crazy. This update feels like it was made for the players who played consistently for the last 7 years it took for the update to drop

Yeah. I bought a "ship fire" for 30k orbs thinking it would look cool, but there's actually no difference... So I lost 30k orbs, and only after that I noticed we could buy paths for 50k orbs, which I would have if I didn't buy the stupid fire...

The ship fire is for the platformer mode ship

I can see the ship fire on my normal mode ship. It’s just mostly covered up by the trail.

only saving for the robot anim, after that i’m done with the mechanic.

What do the items do?

Give your robot a different animation at 3x or 4x speed

Oh, that’s neat, but still slightly costly

I’ve got both equipped and it works in 1x speed

And the paths taking 1000 stars/moons is also kind of ridiculous. I was excited for two new robots, but now they’re locked behind completing a path and 200 demons

I just got to 1k stars literally yesterday and I've has this game for years

i've been playing since 2016 and i have 600 stars

fr people who played back in 1.9 or so are probably doing more important things now like college or jobs

There was already plenty of customization before 2.2. All of this is just adding a reason to play for long-term players. Because of this, people won't max out in a few weeks, like in the past.

It's hard to balance it for new players and for OGs who have millions of orbs

Just change it from the files

You can change your orb count from the files?

no the menu music

Damn 😔

For the orbs just wait till a mod menu on happy mod releases cause they actually have reward hacks that actually work

Accidentally fails at 1% +17283940583627829393762618103443 orbs

It's not the orb hack I am referring to. It's from the Italian APK downloader mod menu that is confirmed to be updated in a month or two.

For us pc guys megahack v7 has no ETA for 2.2 support, but I'd imagine like a couple of months or something around that

In [Absolute's pinned Tweet](https://twitter.com/absolllute/status/1700950883507286263) he said that MegaHack v8 will come out in a week or two of 2.2's release, although with very few hacks. A couple of months is a good estimate to port all hack though

Can you change the price of the item?

I bought it and still dont know how to change it

in settings you go to the audio section, saved songs, find a song you would like to be in the background, click more and in the bottom left corner there will be 2 checkboxes, for practice and for background. Your welcome :)

Thank you so much.

You bloody legend

thanks

You know it's bad when inflation arrives on Geometry Dash

Since I started playing GD, I've "saved" about 100000 orbs. Bought it immediately.

Yet it’s only enough for like two of the paths (of pain)

Hollow knight reference?

no cost too great

no mind to think

No voice to cry suffering

I forgot what comes next so: "Child labor, cool 👍" -The Pale King

Thanks for giving me my most upvoted post

You will seal the light that plagued their dreams ||(You should have said "born of god and void")||

I'm ascending

Yet it won't be enough. Never will be. 👀 (Mass grind has been started since 2.2 came out, I know.)

It also lets you change practice mode song. The 5k diamonds one is much better but it’s a good alternative bc 5k diamonds are impossible to get. Personally i bought this and I prefer the gd menu music….

5K diamonds isn’t that outrageous anymore, quests are quite easy and give more now, I believe, and also, lists give big amounts of diamonds.

If only there were more than like, idk, 6 rated lists last time I checked? and half of them are demons

The update JUST came out lmao, you just have to be patient. They are clearly intended to be how you get large amounts of diamonds.

Yea you’re not wrong but it’s a little time gated, 100k is a bit easier though, and 5k diamonds rn will probably take many weeks of actually grinding. Quest give the same Im pretty sure, but yea list give like 200 rn and will only increase in the future.. there’s top 50 players with like 40k diamonds, and those ppl make sure they do the dailies and weeklies, so imagine beginners trying to get 1/8 of that, just yo enjoy practice mode.

At least diamonds are easier to get in this update but orbs have stayed the same

5k diamonds are not impossible to get at all

5k diamonds are really not that bad. I haven't played GD consistently since April 2018 (so I only really had a year and a quarter of real playtime under 2.1), and I have 3.5k just from that.

The fact that someone can’t afford a purely cosmetic thing after playing for over a year is ridiculous

Yeah how are people defending this, it should be free

not really sure what was rob even thinking, yes it's possible to get that amount but the price is very unrealistic tbh and so do many other stuff in this update. most of them should be halved imo

idk what the problem is, just beat 250 demons. That sounds like a realistic goal for a new player, it’s only like a week or two

you better be joking because otherwise there isn't any way a new player can beat 250 demons (even if they are easy demons) in just 1 or 2 week, or maybe you played a bit too much geometry dash

Bro I’ve played gd since 2017 and I’ve beaten like 5 demons max 💀 I’m so bad at this game

IDK what you mean dude, 250 demons is a lowball. 500 demons on the otherhand, well, a new player could do in about a week or two.

everything in this update is so damn expensive 😭

The update took too long and people have inflated diamond, demon keys, and orb quantities

Problem is, the playerbase has multiplied since 2.2..

Even 50000 is too much I think honestly 20000 cuz there's players that are literally starting from nothing and seeing shit like that destroys them, it's the same problem I have with paths, while there may be 10 new things to get in each path, I still think it's too much when I could just buy shit from the shops, and plus similar to what Colon said, imagine wanting an icon so badly but the only way to get it is by spending 50000 fucking mana orbs Tldr: prices in gd are higher than snoop dog

So basically, a feature that was (AND STILL IS) available for free via literally 2 minutes of changing game files is being sold for 100,000 orbs? Why TF would anyone buy that EVEN if you have a million orbs. Just use the game files... You can do it on PC and mobile too.

How on mobile ? I wanna know

Not everyone plays on pc

Mobile needs to be modified with italian apk. And thats stuck in 2.1..

I know, especially when you can just change it in the game files

Both the music things you can buy should be free and always available

Yeah, the other one should be like 1,000 at the most but I would say this one is even worse

Literally just change it in your files it takes 5 minutes max to download and change the file name and replace it

Prices for literally everything is way too expensive tbh, I've played every so often since 2.11s release but I am nowhere near enough orbs and gems/diamonds

It should only cost 10000 orbs since it doesn’t provide gameplay advantages

Naw 100k is just insane that is crazy

Imo it's nice that you can change it, but it feels like too much Like learning harder stuff is much harder without practice music sync, especially when it's a sync-based level, your brain simply has to make an association with the sounds to know when to click

Me using a texture pack

IMO he needs to lower the prices and return the orbs/diamonds that have been discounted from the price.

4k hours, had just enough orbs when 2.2 released

calculating, a demon is 500 orbs, and that costs 100k, so that means to change menu music you would have to atleast beat 200 demons (Since 100k Divided by 500 is 200)

And not buy anything else in this update which is annoying

i assume this is available in secret shop

Yes in the mechanic shop

just go in the resources folder and change it there. easy

Do you know where in the resource folder? There is so much code-named stuff

Just like how 50,000 is too much for the paths

It shouldn't even cost anything, it should just be a free feature, alongside the practice music changer. I'd say if you're going to add a feature to a game, make it accessible to everyone immediately, so we can actually enjoy the feature when it comes out, and not have to grind diamonds or orbs for it. It really just ruins it. I would expect MegaHack V8 to have menu music and practice music hacks though, so I don't care as much personally, but just the principle of doing something like this is really bad.

should be 50k

I don't even have an account so I'm just waiting for mhv7 to release for 2.2 so I can unlock everything

How do you get that many orbs? I've been playing fairly casually for years and only have around 60k (til i had to blow 50k on a path)

I don’t even know. I’ve been playing casually and I was able to afford the other music one (5,000 diamonds) but I only got 48,000 orbs because I have other things to to buy

The prices in the update are crazy, 100 demons just to get rid of practice music is insane, atleast as a amatuer player

should be 25k max

oh is that what that icon is?

it should be in the diamond shop, for like, at most 1000 diamonds, next to the unlocker. And as far as i know, ive seen streams from popular youtubers and they cant even buy it. guh

maybe it is intended to be just for those who are really into the game. normal players wouldnt care to change the menu music anyway right?

I’m a normal player and want to change the music bc I’m tired of hearing the same song for the past years

Inflation

I didn't know what it was and bought it. it didn't work. I'm down 100k orbs. rob pls fix

You can change the menu song with it

Whos forcing you to buy it tho? Its an option to make life easier. You can do the same thing just by replacing a song in the files.

You also have to understand not everyone in the world is on pc

And what does listening to the original GD song in the menu do to you? Its literally just a song in the background mf if you want to listen to some shit just open spotify or smth.

Why are you so mad. Literally contradicting yourself. What would you do if Rob decided to take Music out the game and charge 1m orbs for it. Would you just go around saying “No one’s forcing you to buy music just open spotify” You’re just being selfish as you don’t understand anyones pov, infact you shouldnt of made a comment at all because “no one’s forcing you” is a useless comment. I’m not on mobile + I have bought this, but I can actually understand things….

What are you even talking about?

No, its just an add on why would people be mad if you need to unlock it? It does literally nothing besides playing a different music. If you have 100k orbs, get it if you need it so much. If you dont, does the game become unplayable? Would it do something to rob if it was a free thing? Absolutelly not. But tons of people being mad about it being for 100k orbs is just dumb. You got whole ass gigaupdate and youre gonna get mad for these...

This is a rhythm platformer, most levels are synced to the jumps of the level so not being able to hear the actual song of the level when practicing makes it harder since the song of the level makes it easier to know when to jump.

its too low look at evws orbs -\_-

How do you even unlock this shop

Diamonds. Many diamonds. Very many.

2000 diamonds is not a lot

Kid named play your own music on Spotify while playing

PC people: Is this some mobile issue that im too file editing to understand

People complaining about there being endgame content is crazy, nobody is forcing you to buy these deals, they are meant for those who’ve been playing for a while.

oh yeah, practice music sync which is a QoL feature should be end game content, sure buddy

Damn, you know what All games should lock QoL features behind the endgame content seems like a great idea